Answer: (b) Mexico. Books. Sericulture is rearing of silkworms for production of silk. The cultivation of crops is done for personal consumption. …, When an animal cell is ready to divide, it begins to make long fibers that attach to the What per cent of persons are engaged in agricultural activity in the world? (a) Barter system (b) Water system (c) Farm system (d) All of these. The rearing of silkworms for the production of raw silk is known as sericulture. chain, identifying the codons, anticodons, and amino acid s These eggs hatch into caterpillar or larvae. Ask your question. What is called reeling the silk? Using the diagram above, answer the following questions: Answer: (d) sericulture. It is a very old occupation in India. Wiki User Answered . Sericulture is also known as silk farming. Rearing of silkworm to produce raw silk is called sericulture. Why is petroleum reffered to as liquid gold? Question 1. Sericulture is the whole process of obtaining silk starting from silk moth. Question 8. Science Biology Evolution and Adaptation Sericulture Ecology Environmental Biology Animal Association … Question 3. 2. …, 27. You will find answers to these questions in the next section – What is Sericulture? balanced equation and give evidence NCERT P Bahadur IIT-JEE Previous Year Narendra Awasthi MS Chauhan. Experts are waiting 24/7 to provide step-by-step solutions in as fast as 30 minutes! Sericulture is the practice of . tnks po sa nag comment ng correct ans :) :) please write the correct answer nmn po salAmsr po sa sagot mali po and answer...the ( ͡° ͜ʖ ͡°) New questions in Art. Sericulture is the process of cultivating silkworms and extracting silk from them. Question 5. Upvote(0) How satisfied are you with the answer? If you need more info, try doing a search on sericulture. (ii) Muslim rule was established in Delhi at the end of the 12th century. Historically sericulture was introduced in china by hoshomin, the queen of china. Favourable condition for the condition for digging a well, How does an artificial satellite differ from a natural satellite. Question 6. Question 8. Sericulture is the process of cultivating silkworms and extracting silk from them. Answer. 1 Thank You. NCERT NCERT Exemplar NCERT Fingertips Errorless Vol-1 Errorless Vol-2. In commercial cultivation, the mulberry garden is generally established through stem cuttings. Find more answers. It is the rearing of silkworms to obtain silk. Sericulture is the cultivation of silk worms on a large scale for the production of silk. Answer. What is ‘slash and burn’ agriculture known as in the north-eastern region of India? toppr. Ans: Silkworm is midsized insect like butterfly having white creamy colour and 2-3 cm length. India Climate Vegetation and Wildlife. Give an example and state the mount... Why most of the south indian rivers flow east ? Question 2. you selected? Although there are several commercial species of silkworms, Bombyx mori (the caterpillar of the domestic silkmoth) is the most widely used and intensively studied silkworm. The stages of silk production are as follows. The best one gets 25 in all. … Answered By . 2014-06-11 21:45:12 2014-06-11 21:45:12. A Sihn B. Batik C. Golden Thread Silk D. Ikat 1 See answer pearlll17 pearlll17 Answer: (5) C. Angkor Wat (6) C. Vietnam (7) B. Sky Lantern (8) D. Songkok (9) A. Merlion (10) D. Ikat-Technique (11) C. Golden Thread. Biology . The rearing of silkworms for obtaining silk is called sericulture. Median response time is 34 minutes and may be longer for new subjects. Historically sericulture was introduced in china by hoshomin, the queen of china. Sericulture; Answer: 1. Labels: General Knowledge. Answer: Silk fibres are animal fibres obtained from cocoons of the silkworm. Explain In simple terms, it is the cultivation of silkworms to produce silk. Question 3. Answer: (a) Sericulture. (iv) The impact of Muslim rule was felt during the reign of Malik Kafur. Answer. MCQ Questions for Class 8 Social Science with Answers were prepared based on the latest exam pattern. What process is occurring at the arrow(s) Answer. • Bombyx mori is the most widely used species of silkworm and intensively studied. (a) North East India (b) Mexico (c) Brazil (d) Malaysia. When the soil fertility decreases, the farmers shift and clear a fresh patch of land for cultivation. MEDIUM. 5) It swings its head from side to side to distribute the saliva which will form silk. AP Village Sericulture Assistant Answer Key 2020 AP Village Sericulture Assistant Answer Papers released with your marks at official website gramasachivalayam.ap.gov.in. Find answers to questions asked by student like you. wHAT IS SERICULTURE. Show more Q&A. Find out the correct statement. This is from wikipedia, I hope it helps. What are the problems of Indian agriculture? 7)The silkworm spins approximately one mile of filament.The silkworm completely encloses itself in the coccon in about two to three days. 2) The silk moth eggs hatch to form larvae or caterpillar known as silkworms.3) The larvae feeds on mulberry leaves. Determine whether this is a correctly 1.Force I need help on this question, I was wondering if you could help me with this please. Share to Twitter Share to Facebook Share to Pinterest. Answer: The rearing of silkworms for obtaining silk is called as sericulture. Get copy of last few answers in your mail. Top Answer. What is sericulture? Sericulture is the production of silk and the rearing of silkworms for this purpose. Question 9. Ask your question. ADVERTISEMENTS: Paragraph on Sericulture! Maths. • Sericulture, or silk farming, is the rearing of silkworms for the production of raw silk. Explain why this is true or false. Still have questions? Category : General Knowledge: Question 928: What is sericulture?. 6. The Chinese people knew the methods of cultivating silk and preparing cloth from it for more than 2000 years. 8) The silk is obtained by brushing the undamaged coccon to find the outside end of the filament. No comments: Post a Comment. Check the below NCERT MCQ Questions for Class 8 Geography Chapter 4 Agriculture with Answers Pdf free download. What is sericulture? Physics. (iii) Arab Muslims had been trading in the ports of the west coast. Answer: Sericulture is the production of silk and the rearing of silkworms for this purpose. Courtesy : wikipedia NCERT DC Pandey Sunil Batra HC Verma Pradeep Errorless. Answer. Answer: Sericulture is the production of silk and the rearing of silkworms for this purpose. New questions in Art. What are th Historically sericulture was introduced in china by hoshomin, the queen of china. …. Ans: the lultivation of silk worm is called sericulture. Why do we need clothes? • The eggs hatch, and the larvae feed on mulberry leaves. Agroforestry, Sericulture, Mushroom cultivation, Fish rearing, Dairy farming, Poultry, Olericulture, Pomology or Floriculture all distinguished field … Sericulture, or silk farming, is the cultivation of silkworms to produce silk. Answer: The rearing of silk moths for the production of silk is called sericulture. We have Provided Agriculture Class 8 Geography MCQs Questions with Answers to help students understand the concept very well. Today, India and China are the chief producers of silk contributing over 60% of the annual production across the globe. Given below is a sequence of steps in the processing of wool. General Knowledge Questions and Answers about Agriculture 1. Elaborate on planning region? What is sericulture ? Question 7. 2015-08-01 13:52:09 2015-08-01 13:52:09 . Kumar adityadev. Sericulture is rearing of silkworms for production of silk. Sericulture definition: the rearing of silkworms for the production of raw silk | Meaning, pronunciation, translations and examples Answer: It is known as Jhumming’ in the north-eastern region of India. Hence sericulture or silk production is dependent on moriculture. The stages of silk production are as follows. Check the below NCERT MCQ Questions for Class 8 Geography Chapter 4 Agriculture with Answers Pdf free download. Silkworms spin the ' silk fibres'. DNA: CGATACAATGGACCCGGTATGCGATATCC, Fossils and fossil fuels D. None of the above. The rearing of silkworms for obtaining silk is called sericulture. Historically sericulture was introduced in china by hoshomin, the queen of china. Answer: (b) Viticulture. Note: There will be a negative marking of (1/4) or 0.25 mark for each wrong answer. b. 2) The silk moth eggs hatch to form larvae or caterpillar known as silkworms .3) The larvae feeds on mulberry leaves. Answer: Subsistence farming is a type of farming that the farmer practices to meet the needs of his family. 0 rearing of silk. 2 ; … II. The breeding and rearing of useful silkworms to obtain commercial silk is known as Sericulture. It is also known as shifting cultivation. Answer: The sheared skin with hair is thoroughly washed in tanks to remove grease, dust and dirt is called scouring. Answered January 30, 2018 Sericulture is a science which deals with rearing of silkworm which final product will be silk. Mention it's characteristics? Which are the important plantation crops in India? (a) Growing of vegetables (b) Growing of flowers (c) Growing of fruits (d) All of the above. Silkworms are used to produce silk. They develop by eating leaves of this plant. Wiki User Answered . 4)Having grown and molted several times silkworm weaves a net to hold itself. Answer. They are also called silk Moths. Sericulture is the raising of silk worms. Agroforestry, Sericulture, Mushroom cultivation, Fish rearing, Dairy farming, Poultry, Olericulture, Pomology or Floriculture all distinguished field … tiny bubbles to deliver them where they need to go. * See Answer *Response times vary by subject and question complexity. The sericulture is an important cottage industry, but is now the basis of large industries in China, Japan, India and some European countries, where the silkworm, Bombyx mori is reared on mulberry leaves on a mass scale to get raw silk from the cocoons of the caterpillars of the moth. Thank you​. Fibre to Fabric Class 6 Extra Questions Short Answer Type. 1)The silk moth lays thousands of eggs . Answer: (d) 50%. Answer: (c) Sericulture Commercial rearing of silkworms is called sericulture. 3. Sericulture is the whole process of obtaining silk starting from silk moth. Share 6. Question 8. Although there are several commercial species of silkworms, Bombyx mori is the most widely used and intensively studied silkworm. Silk was believed to have first been produced in China as early as the Neolithic Period. Recommend (0) Comment (0) person. A uneven twill B. Sericulture C. dying D. Ikat-technique 11. …, equence. Answer . This is cruelty against insects. What is meant by rain shadow area? chromosomes. Without the organelle that does this, the animal You can specify conditions of storing and accessing cookies in your browser, Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide Moreover half of its practice is biology ie plantation of food plants for the worms and taking care of the worms is entomology and the remainig … Find 4 Answers & Solutions for the question What is sericulture? Root wilt and Bud rot are the major diseases of? Apiculture is scientific rearing of honey bees and sericulture is Scientific rearing of silk moths for sik. 4)Having grown and molted several times silkworm weaves a net to hold itself. What is sericulture?. Apiculture is scientific rearing of honey bees and sericulture is Scientific rearing of silk moths for sik. 6) The silk solidifies when it comes in contact with air. The rearing of silkworms for the production of raw silk is known as sericulture. Explore the MCQs for chapter 16 Management of Natural Resources. Life Cycle of silk worm: Female silk worm lays eggs on leaves of mulberry tree. | EduRev Class 7 Question is disucussed on EduRev Study Group by 131 Class 7 Students. Question 14. Rearing of silk worms for obtaining silk is called sericulture. Describe the process or processes you selected. NCERT RD Sharma Cengage KC Sinha. 1)The silk moth lays thousands of eggs. Please enter the OTP sent to your mobile number: Sericulture is rearing of silkworms for production of silk. Answer… But the art of sericulture was held by … The eggs of the silkworm moth hatch out within 10 days into creamy white rapidly moving caterpillars. Answer: Australia. The caterpillars of the domestic silkmoth (also called ‘Bombyx mori’) are the most commonly used silkworm species in sericulture. 8. 0 ; View Full Answer Sericulture, or silk farming, is the rearing of silkworms for the production of raw silk. They are reared in Sericulture. 10. 1 ; MULBERY CULTIVATION. …. Download PDF for offline reading FREE only at BYJU’S. Are you attend the AP Village Sericulture Assistant 2020 Computer based CBT Examination then get you marks and Solved Papers for PDF in Free Download with our page. It is a very old occupation in India. add. Silk firer is obtained from silk worms in sericulture. Answer. 2014: Cool online Exam AtoZ General Knowledge Questions and Answers. Answer these questions. The ancient dynasties of Korea encouraged agriculture and sericulture as the main industries. Sericulture is also known as silk farming. Question 15. What is sericulture? Other types of silkworms (such as Eri, Muga, and Tasar) are also cultivated for the production of ‘wild silks’. It may supplement the income of the farmer. Question 25. 0 ; it is the rearing of silk worms for commercial purposes. Answer is : Growing Silkworms: Posted by MC at 7:40 PM. Class 12 Class 11 Class 10 Class 9 Class 8 Class 7 … …. Answer: The rearing of silkworms for the production of silk fibre is known as sericulture. This process is called shearing. Top Answer. Define sericulture. Answered By . Paragraph on Sericulture! The caterpillars of the domestic silkmoth (also called ‘Bombyx mori’) are the most commonly used silkworm species in sericulture. Both the statements are correct statements. It is the rearing of silkworms to obtain silk. 0 ; View Full Answer -Sericulture involves rearing of silkworms to obtain silk from them.-Sericulture is a small scale industry which involves people working to obtain silk.-Silk worm is reared right from its egg stage cocoons are collected. Which organelle is this . Sericulture is the process of cultivating silkworms and extracting silk from them. What kind of silk worms are reared in Nepal? What is sorting? thank you very much hemapadma275 hemapadma275 Answer: the production of silk and the rearing of silk worms . In this process, silkworms are reared at appropriate temperature and humidity to get silk threads from cocoons. True or False. These are two types of silk worm reared in Nepal, i.e. Get 5 credit points for each correct answer. Related Biology Q&A. Chemistry. your answer. Explanation: not under stand search in google. question_answer. SERICULTURE or silk farming is the rearing of silkworms for the production of raw silk. Answer. ... Sericulture (b) Viticulture (c) Floriculture (d) Horiculture. Recommend (0) Comment (0) person. ask related question comment. Answer. Nov 12,2020 - what is sericulture Related: Steps in Sericulture: From Cocoon to Silk? Question 24. Upvote(0) How satisfied are you with the answer? The arrow labeled C represents a transfer of chemi What does gyrase do during DNA replication? Nov 12,2020 - what is sericulture Related: Steps in Sericulture: From Cocoon to Silk? It involves low levels of technology and household labour to produce a small output. The stages of silk production are as follows. Still have questions? Sericulture, the production of raw silk by means of raising caterpillars (larvae), particularly those of the domesticated silkworm (Bombyx mori). 0 votes . One coccon contains approximately 1000 yards of silk filaments. Answer: cal energy to mechanical energy. Eri-silkworm and seri-silkworm, etc. why this is true or false. Sericulture is a process of rearing of silkworm to obtain silk. A student proposed that the balanced chemical equation for this reaction is: In intensive subsistence agriculture, the farmer cultivates a small plot of land using simple tools and more labour. The important inputs like seeds, fertilisers, machinery etc form a system called as? Sericulture is an agro-based industry. Answer: Silk fibres are animal fibres obtained from cocoons of the silkworm. Class-6 » Social Science. Question 8. Sericulture is also known as silk farming. The caterpillars of the domestic silkmoth (also called ‘Bombyx mori’) are the most commonly used silkworm species in sericulture. Other types of silkworms (such as Eri, Muga, and … The Chinese people knew the methods of cultivating silk and preparing cloth from it for more than 2000 years. Gaurav Teharpuria. Is it always the employees responsibility to make sure they wear their respiratory, The change in an object’s position with respect to time and in comparison to the position of other objects used as reference points * 9) The silk filaments are then wound on a reel . Sericulture is the process of raising silkworms for their silk. Sericulture is the process of cultivating silkworms and extracting silk from them. Although there are several commercial species of silkworms, Bombyx mori is the most widely used and intensively studied. Which arrow or arrows represent a release of carbon dioxide? Answer. Exhaustive questions with answers are provided. Hints: (i) Silk production involves cultivation of mulberry leaves and rearing silkworms. (i) The Mughal era from 15th to 18th century is referred to as the early modem period. Shearing: The fleece of the sheep along with a thin layer of skin is removed from its body. Ask & Answer; School Talk; Login; GET APP; Login Create Account. the production of silk and the rearing of silk worms, This site is using cookies under cookie policy. Describe the structure of a silkworm with a diagram. Nonetheless, owing to the innovative studies and use of state-of-the-art machinery, Silk has become one of the major cash crops of India. The production of silk generally involves two processes: The silkworm caterpillar builds its cocoon by producing and surrounding itself with a long, | EduRev Class 7 Question is disucussed on EduRev Study Group by 131 Class 7 Students. Sericulture is a cottage industry. 9. It involves rearing of silkworms for the production of raw silk, which is the yarn obtained out of cocoons spun by certain species of insects. The above-given table gives the complete structure of the AP Village Sericulture Assistant Test Pattern 2020. Which arrow or arrows indicate a process that cycles carbon from living or nonliving organisms? Which arrow or arrows represent reactions that demonstrate a conservation of mass and energy? 0 ; Silk fibres are valso animal fibres. answered by Lifeeasy Authors. ANSWER. Shifting cultivation is also known as Milpa in which part of the world. Pb(NO3)2 + 2Nal → Pbl, + 2NaNO, Newer Post Older Post Home. Answer: When the cocoons are kept under the sun or boiled or exposed to steam, the silk fibres separate out. Find more answers . Which fibre is the expensive fibre? 4)Having grown and molted several times silkworm weaves a net to hold itself. Rearing of Silkworm: In the beginning, the female silk moth lays hundreds of eggs. We use silk to make clothes and apparels. Sericulture is not very popular with people working for animal protection because sericulture involves killing of larvae for obtaining silk . So all the aspirants make a note of the table and prepare according to the subject wise. Top Answer. What is sericulture? Questions to answer: ... Sericulture Ecology Environmental Biology Animal Association Animal Behavior and Chronology Aquaculture. Which country is the leading producer of wool? 7. Other types of silkworms (such as Eri, Muga, and Tasar) are also cultivated for the production of ‘wild silks’. Question 4. Answer: (d) All of the above Growing vegetables, flowers and fruits for commercial use is known as horticulture. Define Sericulture. Question 7. What is horticulture? Email This BlogThis! Answer: Coconut 2. Sericulture, floriculture, moriculture, apiculture and silviculture. 2) The silk moth eggs hatch to form larvae or caterpillar known as silkworms .3) The larvae feeds on mulberry leaves. a. Tagged in. Answer: It is a type of farming in which farmers clear a patch of land and produce cereals and other food crops to sustain their families. (a) 75% (b) 85% (c) 65% (d) 50%. C. Both of the above. The rearing of silkworms for obtaining silk is called sericulture. toppr. This practice has existed for a very long time. Define sericulture. About 2500 silkworms are required to produce one pound of raw silk. Sericulture. As Sericulture is a cottage industry, it offers exceptional career options to the women of rural India. True or False. Other types of silkworms (such as Eri, Muga, and Tasar) are also cultivated for the production of ‘wild silks’. Answer: Sorting is the process of separating the different textures of hair. for your conclusion. Sericulture, or silk farming, is the cultivation of silkworms to produce silk.Although there are several commercial species of silkworms, Bombyx mori (the caterpillar of the domestic silkmoth) is the most widely used and intensively studied silkworm. Sericulture is the process of rearing of silk worm for obtaining silk. When the packaging warehouse of the cell is done with the proteins, it loads them into Historically sericulture was introduced in china by hoshomin, the queen of china. The arrow labeled A represents a transfer of solar energy to chemical energy. Answer: Silk. The caterpillars of the domestic silkmoth (also called ‘Bombyx mori’) are the most commonly used silkworm species in sericulture. Rearing: The bringing up and looking after the sheep is called rearing. Bachelor of Hospital Administration (BHA), Business System & Infrastructure Management, Indian National Mathematical Olympiad (INMO). These eggs are stored over a clean paper or piece of cloth. 1)The silk moth lays thousands of eggs . 2015-08-01 13:52:09 2015-08-01 13:52:09 . The study of silkworms is called Sericulture. Sericulture / silk farming, is the cultivation of silkworms to produce silk. Sericulture: The rearing of silkworms for obtaining silk is called sericulture. 8 ; View Full Answer THE REARING AND MANAGEMENT OF SILKWORMS IS KNOWN AS SERICULTURE. divide and will die. • Stages of production of silk • The silk moth lays eggs. 1 Answer. Download PDF's. Share with your friends. You may refer to the answer provided by your friends @Others..Good work..keep posting! Question 1. Silk was believed to have first been produced in China as early as the Neolithic Period. Regards. What fabric is found in Vietnam? Answer: When the cocoons are kept under the sun or boiled or exposed to steam, the silk fibres separate out. What is called reeling the silk? cell won't be able to Answer in 10-15 words plz 2 See answers piyushnehra2006 piyushnehra2006 Answer: The rearing of silkworm is called sericulture..... asritadevi2emailcom asritadevi2emailcom Sericulture, or silk farming, is the cultivation of silkworms to produce silk. Explain Want to see this answer and more? Wiki User Answered . The center of weaving and sericulture (silk worn production) for centuries 1 See answer xmariannalangx xmariannalangx Answer: golden thread silk is born in vietnam. Sericulture is the process of raising silkworms for their silk. Silk worms are beneficial and useful insects. View Full Answer rearing of silkworms is known as sericulture. 2.Motion But have you ever wondered where silk came from?
Osaka Metro Lines, Zulu Pet Names For Girlfriend, Lab Technician Training Certification, Nivea Micellar Water Hydration Ingredients, What Do Bees Do With Honey, Lipscomb Winter Id Camp, How Can I Use Castor Seed For Birth Control, Backward Counting Ppt, Cartoon Race Car Images,